Abstract
Background:
Leiomyomas of the gastrointestinal tract (GI) are benign smooth muscle neoplasms with limited genetic characterization. Molecular investigations may improve diagnostic classification and enhance understanding of their biological behavior.
Methods:
RNA sequencing using multiple fusion-detection algorithms was performed on an ileal leiomyoma. Key findings were validated by RT-PCR and Sanger sequencing.
Results:
A MYH11::GLI3 fusion was identified. Additional chimeric transcripts were detected but interpreted as secondary events based on limited read support. The biological relevance of MYH11::GLI3 relates to smooth muscle specific MYH11 expression and GLI3-mediated Hedgehog signaling.
Conclusion:
This study reports, for the first time, the identification of a MYH11::GLI3 chimera in gastrointestinal leiomyoma, thereby expanding the molecular spectrum of these tumors. Deregulation of GLI3 may represent an alternative mechanism of Hedgehog pathway perturbation in this neoplasm. The frequency and clinical significance of GLI3-rearranged gastrointestinal smooth muscle tumors remain to be determined.
Introduction
Mesenchymal tumors of the gastrointestinal (GI) tract comprise a diverse group of neoplasms that are classified according to their cell of origin or line of differentiation into several categories, including adipocytic, fibroblastic/myofibroblastic, neurogenic, myogenic, vascular/perivascular, and tumors of uncertain differentiation [1–3]. Based on their biological behavior, these tumors are further subdivided into benign, intermediate (locally aggressive or rarely metastasizing), and malignant types [1–3].
The most common mesenchymal neoplasm of the GI tract is the gastrointestinal stromal tumor (GIST), which is thought to originate from, or show differentiation toward, the interstitial cells of Cajal [1–3]. Approximately 80% of GISTs harbor activating mutations in the KIT proto-oncogene receptor tyrosine kinase, located on chromosome 4q12, while about 10% carry mutations in the platelet-derived growth factor receptor alpha (PDGFRA), also located on 4q12 [4, 5]. Cytogenetically, GISTs frequently show chromosomal aberrations, most commonly involving losses of chromosome arms 14q, 22q, 1p, and 15q [6]. Immunohistochemically, GISTs typically show strong expression of KIT (CD117), ANO1 (DOG-1), and CD34 [4, 5]. A small subset of GISTs harbor oncogenic fusion genes involving BRAF, FGFR1, and NTRK3 [7, 8]
Leiomyomas are the second most common GI mesenchymal tumors and are typically found in the esophagus, stomach, small intestine, and colon [1, 2, 9]. Histologically, leiomyomas closely resemble normal smooth muscle cells, and immunohistochemically they express DES (desmin), ACTA2 (α-SMA), CALD1 (caldesmon 1), and CNN1 (calponin 1) [1, 2]. In esophageal and gastric leiomyomas, scattered tumor cells may additionally express KIT and ANO1 [10]. Genetic studies of GI leiomyomas are limited. A deletion involving the COL4A5/COL4A6 locus on chromosome Xq22 has been reported in an esophageal leiomyoma [11], genomic imbalances have been detected in three cases [12], and an FN1::ALK fusion gene has been identified in two GI leiomyomas [13]. Because recurrent fusion genes have been identified in uterine and extra-uterine leiomyomas, including gastrointestinal leiomyomas, we performed RNA sequencing to investigate whether a fusion gene or other transcript-level alterations were present in the current tumor.
In the present study, we describe a leiomyoma of the ileum harboring a novel MYH11::GLI3 fusion gene, thereby expanding the molecular spectrum of GI smooth-muscle tumors and providing additional insight into their genetic heterogeneity.
Methods
Total RNA was extracted from tumor tissue stored at −80 °C using the miRNeasy kit (Qiagen, Hilden, Germany) and submitted to the Genomics Core Facility, Norwegian Radium Hospital, Oslo University Hospital, for high-throughput paired-end RNA sequencing. Fusion transcripts were identified using the FusionCatcher, Arriba, and STAR-Fusion algorithms [14–16].
Complementary DNA (cDNA) was synthesized from 400 ng of total RNA using the iScript Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad Laboratories, Hercules, CA, USA). cDNA corresponding to 20 ng of input RNA was used as template for subsequent PCR amplifications with Premix Taq (Takara Bio Europe/SAS, Saint-Germain-en-Laye, France). PCR was performed using the primers MYH11-2F1 (5′-AGATTTGGACGCTCCGGCCTG-3′) and GLI3-899R (5′-AGCGATGGGCTGCTGTGCAAG-3′). The amplified cDNA fragment was subsequently sequenced using the BigDye Direct Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA) with the primers M13For-MYH11-21F1 (5′-TGTAAAACGACGGCCAGTTGGGAGGTGCGTCAGATCCGA-3′) and M13Rev-GLI3-821R1 (5′-CAGGAAACAGCTATGACCCTCGGAAGCAGCAGTGGGGTTC-3′). Sequence data were analyzed using BLAST against the NCBI reference sequences NM_002474.3 (MYH11) and NM_000168.6 (GLI3), and genomic alignment was performed using BLAT and the UCSC Genome Browser with the GRCh38/hg38 human genome assembly [17, 18]. Sequence data have been deposited in GenBank under accession numbers PX926336-PX926343.
Results
Case presentation: A 45-year-old man underwent abdominal computed tomography (CT) because of abdominal discomfort, which revealed an 8 cm tumor localized to the ileum. The tumor was surgically excised without prior biopsy (Figure 1A). On macroscopic examination, the lesion was well circumscribed and showed a white, firm, whorled cut surface (Figure 1B). Histological examination demonstrated a spindle cell neoplasm composed of long intersecting fascicles of elongated cells with blunt-ended, cigar-shaped nuclei and abundant eosinophilic cytoplasm, consistent with a smooth muscle tumor (Figure 1C). Mitotic activity was very low, with only one mitotic figure identified, and no tumor necrosis was observed. Immunohistochemical analysis showed strong positivity for desmin (Figure 1D), h-caldesmon, and smooth muscle actin, while CD117 and DOG1 were negative. As part of the diagnostic workup, G-banding and karyotypic analysis of metaphase spreads revealed the following karyotype: 44–45,XY,der(1)t(1; 7)(p31; q11),-7,der(16)t(7; 16)(p13∼14; p13)[cp10]/46,XY [2]. The tumor was diagnosed as an ileal leiomyoma.
FIGURE 1
Analysis of RNA-sequencing data using the three fusion-detection algorithms FusionCatcher, Arriba, and STAR-Fusion identified two fusion genes, MYH11::GLI3 and USP48::TSPAN2, both detected by all three algorithms (Table 1; Figure 2; Supplementary Figure S1; Supplementary Figure S2). In addition, two further fusion genes, TSPAN2::URGCP and SUCO::RABGAP1L, were detected by FusionCatcher and Arriba but were not retained in the final STAR-Fusion output (Table 1; Supplementary Figure S3; Supplementary Figure S4). RT-PCR and Sanger sequencing confirmed the MYH11::GLI3 fusion, demonstrating fusion of MYH11 exon 1 to GLI3 exon 5 (Figure 2). No additional chimeric transcripts were investigated.
TABLE 1
| Fusion gene | 5′- partner fusion point | 3′- partner fusion point | Junction-crossing reads | Fusion sequence | GenBank accession number | ||
|---|---|---|---|---|---|---|---|
| FusionCatcher | Arriba | STAR-fusion | |||||
| MYH11::GLI3 | 16:15856941:- | 7:42048696:- | 31 | 303 | 1,114 | CGAGCTCGCCATCCAGTTTCCTCTCCACTAGTCCCCCCAGTTGGAGATCT::GACTTCCGCCTTATCTAGTAGCCCTACGTATCCGGACCTGCCCTTCATTA | PX926336 |
| 16:15856941:- | 7:42048765:- | 4 | Not detected | Not detected | CGAGCTCGCCATCCAGTTTCCTCTCCACTAGTCCCCCCAGTTGGAGATCT::AGACAGCCTCTGCCTGTGGAGATATTTGTCTCATGCATACCCCTTGTATC | PX926337 | |
| 16:15856941:- | 7:42040239:- | 2 | 1 | Not detected | GCCATCCAGTTTCCTCTCCACTAGTCCCCCCAGTTGGAGATCT::GCACCAGATTCTCCAGCCCCAGGCTGTCAGCCAGGCCGAGCCG | PX926338 | |
| USP48::TSPAN2 | 1:21695066:- | 1:115073007:- | 18 | 12 | 19 | TCTCGTTTCTGCTAATCAGACGTTAAAAGAATTGAAAATTCAG::CTGGCTGGATCGGCCGTCATTGCTTTTGGACTATGGTTTCGGT | PX926339 |
| TSPAN2::URGCP | 1:115089364:- | 7:43887816:- | 6 | 3 | Not detected | GTGCATCAAGTACCTGCTGCTTGGCTTCAACCTGCTCTTCTGG::GATAGAAGTGGAATTACTGGGCAAAGGGCATTCAGATTTGGGA | PX926340 |
| 1:115089364:- | 7:43887485:- | Not detected | 1 | Not detected | GCGGTGCATCAAGTACCTGCTGCTTGGCTTCAACCTGCTCTTCTGG::GCATTCAGATTTGGGAGAAGTAGCCCCAGAAATAAAAGCATCAGAG | PX926341 | |
| SUCO::RABGAP1L | 1:172591071:+ | 1:174370979:+ | 2 | 1 | Not detected | AATCGTGAAACTTCAGAATACTTCAAGAATAGCAGAGGAGCAG::AGAGTGATAATGAACTCTCAAGTGGAACAGGTGATGTGTCTAA | PX926342 |
| 1:172533497:+ | 1:174393995:+ | Not detected | 1 | Not detected | CGGCGGGCCTTGGCCCTGGTCTCCTGCCTCTTTCTGTGCTCTCTGGTCTG::GCACAGTAACCTTGGTGCACGACCGAAAGGGCTGTCTACTCTGGTGAAGA | PX926343 | |
Fusion transcripts identified by RNA sequencing using three fusion-detection algorithms in an ileal leiomyoma. Junction-crossing read counts are shown for each fusion-detection algorithm. Fusions with low read support or detected by a subset of callers were interpreted as secondary events.
FIGURE 2
Discussion
To our knowledge, this study is the first report of GLI3 rearrangement and formation of a MYH11::GLI3 fusion in an enteric leiomyoma, thereby expanding the molecular spectrum of these neoplasms. The predicted fusion structure suggests that regulatory sequences from MYH11 may drive aberrant expression of GLI3, potentially leading to dysregulated transcriptional activity.
The MYH11::GLI3 fusion is consistent with involvement of the derivative chromosome der(16)t(7; 16)(p13∼14; p13). Both MYH11 and GLI3, located at chromosome bands 16p13 and 7p14, respectively, are transcribed in a centromere-to-telomere orientation. Accordingly, the MYH11::GLI3 chimera is most likely located on the aberrant chromosome der(16) (Figure 2).
The additional chimeric genes (USP48::TSPAN2, TSPAN2::URGCP, and SUCO::RABGAP1L) are compatible with rearrangements involving chromosome 1, consistent with the presence of the derivative chromosome der(1)t(1; 7)(p31; q11) identified by chromosome banding analysis. In particular, involvement of USP48 (1p36.2), TSPAN2 (1p13.2), and URGCP (7p13) indicates that multiple breakpoints involving chromosome arms 1p and 7p have occurred in the generation of the derivative chromosome der(1)t(1; 7).
These additional chimeric genes were regarded as secondary or passenger events, arising in the context of underlying chromosomal complexity rather than representing biologically driving alterations. This interpretation was based on their low read support across fusion-detection algorithms and restricted detection to a subset of fusion callers (Table 1).
In contrast, the MYH11::GLI3 fusion is of particular biological relevance. This is supported by its high read counts across fusion-detection algorithms (Table 1; Figure 2), the involvement of MYH11 as a 5′ fusion partner, and the well-established role of GLI3 as a transcriptional regulator with dosage-sensitive biological effects [19].
The MYH11 gene encodes smooth muscle myosin heavy chain and is a well-established marker of smooth muscle differentiation [20]. Its expression is driven by a promoter that is among the most specific and tightly regulated in differentiated smooth muscle cells [21]. MYH11 rearrangements are best known from the chromosomal aberrations inv(16)(p13q22) and t(16; 16) in acute myeloid leukemia, resulting in the CBFB::MYH11 fusion [22, 23]. MYH11 has only rarely been implicated in solid tumors [24]. Its involvement as the 5′ fusion partner in the present case is consistent with the smooth-muscle phenotype of the tumor and suggests that MYH11 may contribute regulatory elements that drive aberrant expression of the fusion partner.
The GLI3 gene (7p14.1), together with GLI1 (12q13.3), GLI2 (2q14.2), and GLI4 (8q24.3), encodes the members of the GLI family of zinc-finger transcription factors [25]. These transcription factors bind to the consensus DNA sequence 5′-GACCACCCA-3′ in the promoters of target genes, regulate their transcriptional activity, and act as transcriptional mediators of the Hedgehog signaling pathway [26–29]. Aberrant activation of Hedgehog signaling has been implicated in the initiation and progression of multiple cancer types and contributes to diverse aspects of tumorigenesis [30–34].
GLI3 is unique among members of the GLI family in that it can function either as a transcriptional activator or as a transcriptional repressor, depending on cellular context and Hedgehog pathway activity [19, 35, 36]. In the presence of Hedgehog signaling, full-length GLI3 accumulates and acts as a transcriptional activator, commonly referred to as GLI3A, thereby promoting expression of downstream target genes [19, 35]. In the absence of Hedgehog signaling, full-length GLI3 undergoes proteolytic processing to generate a truncated repressor form, designated GLI3R, which translocates to the nucleus and suppresses transcription of Hedgehog target genes [19, 36, 37].
The main MYH11::GLI3 fusion transcript, detected by all three fusion-detection algorithms, joins the untranslated exon 1 of MYH11 to exon 5 of GLI3. As a consequence, GLI3 exons 1-4, including the canonical translation initiation codon (ATG) located in exon 2, are absent from the chimeric transcript. However, exon 5 of GLI3, which is retained in the fusion, contains internal ATG codons that may serve as alternative translation initiation sites (Figure 2). An alternative MYH11::GLI3 fusion transcript, detected by FusionCatcher and Arriba, joins exon 1 of MYH11 to exon 7 of GLI3, which likewise contains internal ATG codons that may function as alternative translation initiation sites (Table 1; Supplementary Figure S1). Translation from these internal start codons would be predicted to generate an N-terminally truncated GLI3 protein retaining the DNA-binding zinc-finger domain and downstream C-terminal functional domains. Based on the predicted fusion structure, the retained region would correspond to amino-acid residues 201–1,580 of the GLI3 reference protein (NP_000159.3), or residues 309–1,580 in the alternative fusion transcript. Importantly, expression of the MYH11::GLI3 fusion transcript would be driven by the highly specific and tightly regulated MYH11 promoter, potentially resulting in lineage-restricted, aberrant expression of truncated GLI3 in smooth muscle cells. Support for the plausibility of this mechanism comes from experimental evidence demonstrating that GLI3 can be translated from non-canonical start sites [38]. In a CRISPR-Cas9 study targeting the endogenous GLI3 gene, cells carrying biallelic out-of-frame mutations were nevertheless found to express GLI3 protein, despite disruption of the canonical reading frame [38]. The authors attributed this unexpected protein expression to illegitimate translation, likely initiated from internal or non-canonical start codons downstream of the mutations. These findings indicate that GLI3 is permissive to alternative translation initiation and can give rise to truncated but stable protein products [38]. In the context of the present MYH11::GLI3 fusion, a similar mechanism may operate, whereby internal ATG codons within GLI3 exon 5 or exon 7 serve as alternative translation initiation sites, resulting in expression of an N-terminally truncated GLI3 protein retaining key functional domains (Figure 2; Supplementary Figure S1). Although protein-level validation was not feasible in the present case, the transcript structure and prior experimental evidence support the biological plausibility of this mechanism. Such non-canonical translation mechanisms are increasingly recognized in cancer and developmental contexts, where alternative start codon usage and truncated protein isoforms may contribute to oncogenic signaling diversity [39–43].
Recently, GLI1-enteric tumors have been proposed as a distinct subgroup within GLI-altered neoplasms, separable from other tumor types, particularly myoepithelial tumors of soft tissue and glomus tumors [44, 45]. These tumors generally follow an indolent clinical course, but may carry an increased risk of aggressive behavior when exceeding 5 cm in size or exhibiting high-grade morphology [44, 45]. MALAT1::GLI1 and ACTB::GLI1 represent the most frequently identified fusion genes in GLI1-enteric tumors; however, these fusions are not disease-defining, as they are also observed in plexiform fibromyxoma and gastroblastoma [44, 45].
The identification of a MYH11::GLI3 fusion in the present ileal leiomyoma suggests that deregulation of GLI3 represents an alternative mechanism of Hedgehog pathway perturbation in enteric tumors and, more broadly, in gastrointestinal smooth-muscle neoplasms. Given that MYH11 expression is driven by a promoter that is highly specific and tightly regulated in differentiated smooth muscle cells, the MYH11::GLI3 fusion may result in lineage-restricted, aberrant expression of GLI3 in smooth-muscle cells. Whether this fusion alters the balance between GLI3 activator and repressor functions, or instead leads to ectopic or deregulated GLI3 expression driven by the MYH11 promoter and independent of canonical Hedgehog pathway regulation, remains to be determined.
From a diagnostic perspective, gastrointestinal smooth muscle tumors that do not fully meet established criteria for leiomyoma or leiomyosarcoma remain challenging entities. As illustrated by the present case, genetic investigations may contribute to improved diagnostic classification and a better understanding of biological behavior. In selected cases, identification of a MYH11::GLI3 fusion may serve as a molecular marker of smooth muscle differentiation and help define a genetically distinct subset of enteric tumors. The apparent rarity of GLI3 rearrangements may reflect biological constraints and tissue-specific detection bias, rather than true absence. More broadly, the identification of recurrent or characteristic fusion genes may, in the future, help refine the classification of gastrointestinal smooth muscle tumors and distinguish biologically distinct subsets within this heterogeneous group.
Conclusion
The present case expands the spectrum of fusion genes identified in gastrointestinal smooth muscle tumors and highlights MYH11::GLI3 as a novel fusion gene in this setting. Further studies are warranted to determine the frequency of GLI3 rearrangements, identify potential alternative 5′ fusion partners, and clarify their biological and clinical significance in gastrointestinal smooth muscle tumors.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.
Ethics statement
The studies involving humans were approved by the Regional Committee for Medical Research Ethics South East Norway. The ethics committee’s approval included a review of the consent procedure. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study. Written informed consent was not obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article because the manuscript does not contain any identifiable patient information. All figures are anonymized histopathological images and schematic representations of molecular findings that do not allow identification of the individual. Written informed consent was, however, obtained from the participant for participation in the research and for publication of the data. Given the nature of the material presented, no additional, figure-specific consent was required.
Author contributions
IP conceived and performed the experiments and analyzed data. IL performed histopathological and immunohistochemical examinations. IP takes full responsibility for the work as a whole, including the study design, access to data, and the decision to submit and publish the manuscript. All authors contributed to the article and approved the submitted version.
Funding
The author(s) declared that financial support was not received for this work and/or its publication.
Acknowledgments
The authors thank Dr. Kjetil Boye for valuable assistance with patient consent and for serving as the responsible investigator for the REK-approved research project under which this study was conducted. The authors also thank Kristin Andersen (Section of Cancer Cytogenetics, Oslo University Hospital-Radiumhospitalet) for excellent technical assistance.
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that generative AI was used in the creation of this manuscript. The author used the AI language model ChatGPT (OpenAI, San Francisco, CA, USA) for editorial assistance limited to grammar correction and improvement of English readability. The AI tool had no role in study design, data collection, data analysis, or interpretation. The author retains full responsibility for the scientific content, accuracy, data interpretation, and conclusions presented in this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.por-journal.com/articles/10.3389/pore.2026.1612375/full#supplementary-material
References
1.
SbaragliaMBusinelloGBellanEFassanMDei TosAP. Mesenchymal tumours of the gastrointestinal tract. Pathologica (2021) 113(3):230–51. 10.32074/1591-951x-309
2.
GamaJMOliveiraRC. Mesenchymal tumors of the gastrointestinal tract-beyond GIST-a review. Gastrointest Disord (2024) 6(1):257–91. 10.3390/gidisord6010019
3.
KőváriBPLauwersGY. Mesenchymal tumors of the tubular gastrointestinal tract (non-gist): the gi pathologist's approach. Adv Anat Pathol (2025) 32(2):110–31. 10.1097/PAP.0000000000000469
4.
SerranoCMartin-BrotoJAsencio-PascualJMLopez-GuerreroJARubio-CasadevallJBagueSet alGEIS guidelines for gastrointestinal stromal tumors. Ther Adv Med Oncol (2023) 15:17588359231192388. 10.1177/17588359231192388
5.
JudsonIJonesRLWongNDileoPBulusuRSmithMet alGastrointestinal stromal tumour (GIST): british sarcoma group clinical practice guidelines. Br J Cancer (2025) 132(1):1–10. 10.1038/s41416-024-02672-0
6.
GorunovaLBoyeKPanagopoulosIBernerJMBjerkehagenBHomplandIet alCytogenetic and molecular analyses of 291 gastrointestinal stromal tumors: site-specific cytogenetic evolution as evidence of pathogenetic heterogeneity. Oncotarget (2022) 13:508–17. 10.18632/oncotarget.28209
7.
ShiEChmieleckiJTangCMWangKHeinrichMCKangGet alFGFR1 and NTRK3 actionable alterations in “Wild-Type” gastrointestinal stromal tumors. J Transl Med (2016) 14(1):339. 10.1186/s12967-016-1075-6
8.
TorrenceDXieZZhangLChiPAntonescuCR. Gastrointestinal stromal tumors with BRAF gene fusions. A report of two cases showing low or absent KIT expression resulting in diagnostic pitfalls. Genes Chromosomes Cancer (2021) 60(12):789–95. 10.1002/gcc.22991
9.
PrasadASShanbhogueKPRamaniNSBalasubramanyaRSurabhiVR. Non-gastrointestinal stromal tumor, mesenchymal neoplasms of the gastrointestinal tract: a review of tumor genetics, pathology, and cross-sectional imaging findings. Abdom Radiol (NY) (2024) 49(5):1716–33. 10.1007/s00261-024-04329-1
10.
DeshpandeANelsonDCorlessCLDeshpandeVO'BrienMJ. Leiomyoma of the gastrointestinal tract with interstitial cells of cajal: a mimic of gastrointestinal stromal tumor. Am J Surg Pathol (2014) 38(1):72–7. 10.1097/PAS.0b013e3182a0d134
11.
HeidetLBoyeECaiYSadoYZhangXFlejouJFet alSomatic deletion of the 5' ends of both the COL4A5 and COL4A6 genes in a sporadic leiomyoma of the esophagus. Am J Pathol (1998) 152(3):673–8.
12.
Sarlomo-RikalaMEl-RifaiWLahtinenTAnderssonLCMiettinenMKnuutilaS. Different patterns of DNA copy number changes in gastrointestinal stromal tumors, leiomyomas, and schwannomas. Hum Pathol (1998) 29(5):476–81. 10.1016/s0046-8177(98)90063-6
13.
PanagopoulosIGorunovaLLund-IversenMLobmaierIBjerkehagenBHeimS. Recurrent fusion of the genes FN1 and ALK in gastrointestinal leiomyomas. Mod Pathol (2016) 29(11):1415–23. 10.1038/modpathol.2016.129
14.
KangaspeskaSHultschSEdgrenHNicoriciDMurumagiAKallioniemiO. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms. PLoS One (2012) 7(10):e48745. 10.1371/journal.pone.0048745
15.
UhrigSEllermannJWaltherTBurkhardtPFrohlichMHutterBet alAccurate and efficient detection of gene fusions from RNA sequencing data. Genome Res (2021) 31(3):448–60. 10.1101/gr.257246.119
16.
HaasBJDobinALiBStranskyNPochetNRegevA. Accuracy assessment of fusion transcript detection via read-mapping and de novo fusion transcript assembly-based methods. Genome Biol (2019) 20(1):213. 10.1186/s13059-019-1842-9
17.
KentWJ. BLAT--the BLAST-like alignment tool. Genome Res (2002) 12(4):656–64. 10.1101/gr.229202
18.
KentWJSugnetCWFureyTSRoskinKMPringleTHZahlerAMet alThe human genome browser at UCSC. Genome Res (2002) 12(6):996–1006. 10.1101/gr.229102
19.
MatissekSJElsawaSF. GLI3: a mediator of genetic diseases, development and cancer. Cell Commun Signal (2020) 18(1):54. 10.1186/s12964-020-00540-x
20.
MianoJMCserjesiPLigonKLPeriasamyMOlsonEN. Smooth muscle myosin heavy chain exclusively marks the smooth muscle lineage during mouse embryogenesis. Circ Res (1994) 75(5):803–12. 10.1161/01.res.75.5.803
21.
ChakrabortyRSaddoukFZCarraoACKrauseDSGreifDMMartinKA. Promoters to study vascular smooth muscle. Arterioscler Thromb Vasc Biol (2019) 39(4):603–12. 10.1161/ATVBAHA.119.312449
22.
LiuPTarleSAHajraAClaxtonDFMarltonPFreedmanMet alFusion between transcription factor CBF beta/PEBP2 beta and a myosin heavy chain in acute myeloid leukemia. Science (1993) 261(5124):1041–4. 10.1126/science.8351518
23.
ShurtleffSAMeyersSHiebertSWRaimondiSCHeadDRWillmanCLet alHeterogeneity in CBF beta/MYH11 fusion messages encoded by the inv(16)(p13q22) and the t(16;16)(p13;q22) in acute myelogenous leukemia. Blood (1995) 85(12):3695–703. 10.1182/blood.V85.12.3695.bloodjournal85123695
24.
PanagopoulosIAndersenKBrunettiMGorunovaLKostolomovIKildalWet alPathogenetic dichotomy in angioleiomyoma. Cancer Genomics Proteomics (2023) 20(6):556–66. 10.21873/cgp.20405
25.
RuppertJMKinzlerKWWongAJBignerSHKaoFTLawMLet alThe GLI-kruppel family of human genes. Mol Cell Biol (1988) 8(8):3104–13. 10.1128/mcb.8.8.3104
26.
KinzlerKWVogelsteinB. The GLI gene encodes a nuclear protein which binds specific sequences in the human genome. Mol Cell Biol (1990) 10(2):634–42. 10.1128/mcb.10.2.634
27.
InghamPWMcMahonAP. Hedgehog signaling in animal development: paradigms and principles. Genes Dev (2001) 15(23):3059–87. 10.1101/gad.938601
28.
CarballoGBHonoratoJRde LopesGPFSpohrT. A highlight on sonic hedgehog pathway. Cell Commun Signal (2018) 16(1):11. 10.1186/s12964-018-0220-7
29.
SabolMTrnskiDMusaniVOzretićPLevanatS. Role of GLI transcription factors in pathogenesis and their potential as new therapeutic targets. Int J Mol Sci (2018) 19(9):2562. 10.3390/ijms19092562
30.
CaroILowJA. The role of the hedgehog signaling pathway in the development of basal cell carcinoma and opportunities for treatment. Clin Cancer Res (2010) 16(13):3335–9. 10.1158/1078-0432.CCR-09-2570
31.
CochraneCRSzczepnyAWatkinsDNCainJE. Hedgehog signaling in the maintenance of cancer stem cells. Cancers (Basel) (2015) 7(3):1554–85. 10.3390/cancers7030851
32.
FattahiSPilehchian LangroudiMAkhavan-NiakiH. Hedgehog signaling pathway: epigenetic regulation and role in disease and cancer development. J Cell Physiol (2018) 233(8):5726–35. 10.1002/jcp.26506
33.
SariINPhiLTHJunNWijayaYTLeeSKwonHY. Hedgehog signaling in cancer: a prospective therapeutic target for eradicating cancer stem cells. Cells (2018) 7(11):208. 10.3390/cells7110208
34.
PietrobonoSGagliardiSSteccaB. Non-canonical hedgehog signaling pathway in cancer: activation of gli transcription factors beyond smoothened. Front Genet (2019) 10:556. 10.3389/fgene.2019.00556
35.
DaiPAkimaruHTanakaYMaekawaTNakafukuMIshiiS. Sonic hedgehog-induced activation of the Gli1 promoter is mediated by GLI3. J Biol Chem (1999) 274(12):8143–52. 10.1074/jbc.274.12.8143
36.
TsanevRVanataluKJarvetJTannerRLaurKTiigimagiPet alThe transcriptional repressor domain of Gli3 is intrinsically disordered. PLoS One (2013) 8(10):e76972. 10.1371/journal.pone.0076972
37.
WenXLaiCKEvangelistaMHongoJAde SauvageFJScalesSJ. Kinetics of hedgehog-dependent full-length Gli3 accumulation in primary cilia and subsequent degradation. Mol Cell Biol (2010) 30(8):1910–22. 10.1128/MCB.01089-09
38.
MakinoSFukumuraRGondoY. Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9. Sci Rep (2016) 6:39608. 10.1038/srep39608
39.
KearseMGWiluszJE. Non-AUG translation: a new start for protein synthesis in eukaryotes. Genes Dev (2017) 31(17):1717–31. 10.1101/gad.305250.117
40.
JamesCCSmythJW. Alternative mechanisms of translation initiation: an emerging dynamic regulator of the proteome in health and disease. Life Sci (2018) 212:138–44. 10.1016/j.lfs.2018.09.054
41.
SriramABohlenJTelemanAA. Translation acrobatics: how cancer cells exploit alternate modes of translational initiation. EMBO Rep (2018) 19(10):e45947. 10.15252/embr.201845947
42.
CaoXSlavoffSA. Non-AUG start codons: expanding and regulating the small and alternative ORFeome. Exp Cell Res (2020) 391(1):111973. 10.1016/j.yexcr.2020.111973
43.
MaheMRios-FullerTKatsaraOSchneiderRJ. Non-canonical mRNA translation initiation in cell stress and cancer. NAR Cancer (2024) 6(2):zcae026. 10.1093/narcan/zcae026
44.
JessurunJOrrCMcNultySNHagenCEAlnajarHWilkesDet alGLI1-rearranged enteric tumor: expanding the spectrum of gastrointestinal neoplasms with GLI1 gene fusions. Am J Surg Pathol (2023) 47(1):65–73. 10.1097/PAS.0000000000001950
45.
YounesAIMejbelHA. GLI1-rearranged enteric tumors: updates on clinicopathologic and molecular genetics features. Cells (2025) 14(2):118. 10.3390/cells14020118
Summary
Keywords
fusion gene, gastrointestinal tract, ileum, leiomyoma, MYH11::GLI3
Citation
Panagopoulos I and Lobmaier I (2026) Novel MYH11::GLI3 fusion in ileal leiomyoma. Pathol. Oncol. Res. 32:1612375. doi: 10.3389/pore.2026.1612375
Received
25 January 2026
Revised
12 March 2026
Accepted
27 March 2026
Published
13 April 2026
Volume
32 - 2026
Edited by
Zsolt Orosz, Nuffield Orthopaedic Centre, United Kingdom
Updates
Copyright
© 2026 Panagopoulos and Lobmaier.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Ioannis Panagopoulos, ioapan@ous-hf.no
ORCID: Ioannis Panagopoulos, orcid.org/0000-0003-2159-5341
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.