This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Laryngeal squamous cell carcinoma (LSCC) is a common subtype of head and neck squamous cell carcinoma (HNSCC), with increased incidence year by year [
Long noncoding RNAs (lncRNAs) with over 200 nucleotides in length have been widely concerned for their versatile functions on the development of tumors [
Methyltransferase enhancer of zeste homolog 2 (EZH2) is a well-known catalyzer for polycomb repressive complex 2 (PRC2) that could modulate the oncogenic effect of XIST in LSCC [
Based on the aforementioned evidences, we hypothesized that EZH2 might bind the promoter of its downstream genes and regulate the expression levels of KLF2, DKK-1, CDKN1C, ZEB1, ACE2, Robo4, P4HA1, and DUXAP8 to mediate LSCC development. The current study investigated the impact of LINC-PINT on EZH2 expression. We also explored whether LINC-PINT could recruit EZH2 to the promoter of the aforementioned genes and then regulated the expression levels of these genes in the LSCC cell line TU-177 and Hep-2 carcinoma cells. This study was adopted to understand the roles and possible mechanisms of LINC-PINT in cancer development with regard to the regulation of ZEB1 expression.
LSCC tissues and corresponding adjacent normal margin (ANM) tissues were from patients (
An LSCC cell line TU-177 and a Hela derivative Hep-2 (from American Type Culture Collection, ATCC) and normal human oral keratinocytes (NHOKs, from Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences) were cultured in RPMI1640 (72400120, GIBCO, NY, United States) containing 10% fetal bovine serum (FBS, 16140071, GIBCO, NY, United States) at 37°C in a 5% CO2 incubator.
pcDNA3.1 plasmid with LNC-PINT overexpression (pcDNA3.1-LINC-PINT), ZEB1 overexpression (pcDNA3.1-ZEB1) and EZH2 overexpression (pcDNA3.1-EZH2), short-hairpin RNA of LINC-PINT (sh-LINC-PINT) and EZH2 (sh-EZH2) and corresponding negative controls (pcDNA3.1-NC and sh-NC) were bought from Shanghai Genechem Co., Ltd. (Shanghai, China). Cells were cultured in 60 mm culture dishes for 24 h at a density of 3.0 × 105 cells/dish. Afterward, the cells were cultured with 3 μg of the aforementioned plasmid or shRNA, Lipofectamine 2,000 reagent (11668019, Invitrogen, CA, United States), Opti-MEM I Reduced Serum Medium (31985062, GIBCO, NY, United States) and 8 ng/ml polybrene (TR-1003, Sigma-Aldrich, St. Louis, MO, United States) for 48 h.
The cells were accordingly assigned into Control group, pcDNA3.1-LINC-PINT group, sh-LINC-PINT group, pcDNA3.1-EZH2 group, sh-EZH2 group, pcDNA3.1-ZEB1 group and pcDNA3.1-LINC-PINT + pcDNA3.1-ZEB1 group.
Proliferation rate of cells were measured by a CCK-8 kit (Beyotime, Shanghai, China). Transfected cells (3,000 cells/well) were pipetted into a 96-well plate, and fresh culture medium was replaced every day. Then, the proliferation rate of the cells were detected by the CCK-8 kit every 24 h for 5 consecutive days. In short, 10 μL of CCK-8 solution was added into each well and cultured with the cells for 2 h at 37°C, after which the absorbance was measured at 450 nm using the microplate reader SpectraMax M5 (Molecular Devices).
Tissues or cells were lyzed in 1 ml of Trizol reagent (Thermo Fisher Scientific, MA, United States) and total RNAs were isolated following the manufacturer’s directions. Reverse transcription was conducted to obtain cDNA with the assistance of M-MLV reverse transcriptase and arbitrary primers. Reaction conditions for qRT-PCR were configured in line with the instructions of Premix Ex Taq™II kit (Takara, Dalian, China), and the ABI7500 quantitative PCR instrument (Applied Biosystems, Shanghai, China) was employed for RT-PCR analysis. GAPDH was used for normalization, and relative mRNA levels of genes were analyzed by 2−ΔΔCt method. ΔΔCt = [Ct (target gene)–Ct (internal reference)]experimental group–[Ct (target gene)–Ct (internal reference)]control group. Names and sequences of primers used in this study were listed (
Names and sequences of all primers.
Name of primer | Sequences (5′-3′) |
---|---|
LINC-PINT-F | CGTGGGAGCCCCTTTAAGTT |
LINC-PINT-R | GGGAGGTGGCGTAGTTTCTC |
EZH2-F | AGTCACTGGTCACCGAACAC |
EZH2-R | TTGGGTAGGCAGCATCTCTT |
ZEB1-F | TCGGAAAGAGCTGTTCGCTT |
ZEB1-R | AGGAGGGGGCTGACATACAT |
CDKN1C-F | CACCTTGGGACCAGTGTACC |
CDKN1C-R | CTCCTCGCAGTTTAGAGCCC |
KLF2-F | CGGGAGGAGAGGTCGGATT |
KLF2-R | AGACTGTCTCCCTAGCCACG |
DKK-1-F | TCCTACTGTCTTCTCCTTCGT |
DKK-1-R | GCACAACACAATCCTGAGGC |
ACE2-F | GTGGTGGTGGTATCGGAGTG |
ACE2-R | ACAGCAGTAGCCTGTACTTCG |
Robo4-F | ATCACCAGCAACACCCCAAA |
Robo4-R | GGTTTTCTGGCAAACTCGCA |
P4HA1-F | CCAAGCCACAGGTGATTGGA |
P4HA1-R | TGGCTGTTCTTACTGCCACTT |
DUXAP8-F | TTAGTCTGATGCCGTGGGTG |
DUXAP8-R | GCTTCCTTAGTGAGCTTTCCC |
GAPDH-F | GTGGCTGGCTCAGAAAAAGG |
GAPDH-R | GGGGAGATTCAGTGTGGTGG |
F, forward; R, reverse.
Tissues and cells were lyzed to obtain proteins using lysis buffer, and the protein concentration was then quantified by a BCA kit (23,227, Thermo Fisher, United States). Subsequently, the proteins were diluted by 5 × loading buffer and separated in 12% separating gel using electrophoresis for 90 min. After being blocked by 1 × PBS containing 5% (w/v) skim milk powder at room temperature for 1 h, the proteins were incubated with primary antibodies, including anti-EZH2 antibody (1:500, ab186006, Cambridge, United Kingdom), anti-ZEB1 antibody (1:500, ab203829, Cambridge, United Kingdom), anti-AKT antibody (1:500, ab38449, abcam, Cambridge, United Kingdom), anti-p-AKT antibody (1:500, ab8805, abcam, Cambridge, United Kingdom), anti-mTOR antibody (1:500, ab32028, abcam, Cambridge, United Kingdom), anti-p-mTOR antibody (1:500, ab109268, abcam, Cambridge, United Kingdom), anti-RPS6KB1 antibody (S6K1, 1:500, ab32529, abcam, Cambridge, United Kingdom), and anti-p-RPS6KB1 antibody (p-S6K1, 1:500, ab59208, abcam, Cambridge, United Kingdom) at 4°C overnight. Thereafter, the proteins were rinsed and incubated with the secondary antibody (1:500, ab150077, abcam, Cambridge, United Kingdom) at room temperature for 1 h before being photographed on BioSpectrum Imaging System (UVP, United States).
A Cytoplasmic and Nuclear RNA Purification Kit (cat no.21000; Norgen Biotek, Thorold, ON, United States) was used for the purification of nuclear and cytoplasmic RNA as previously described [
Cells (1 × 105) from the experimental and control groups were pipetted into 12-well plates and a scratch was made by a 10 μL pipette tip vertically when the cell confluence reached 100%. Exfoliated cells and cell debris were washed off by DPBS (14190250, GIBCO, NY, United States) three times, and then the adherent cells were cultured in fresh DMEM supplemented with 2% FBS. Then, the cells were observed by an Olympus inverted microscope at 0 and 24 h under the same field to assess the changes of the scratch. Migration rate = (gap between the scratch at 0 h–gap between the scratch at 24 h)/gap between the scratch at 0 h. The results were from three independent experiments.
Invasiveness and migratory capacity of Hep2 and TU-177 cells were measured by using a Transwell (Corning, NY, United States). After transfection, cells (3 × 104) in the experimental and control groups were suspended in culture medium containing 1% FBS and seeded onto an apical chamber. Then, 0.8 ml of culture medium with 10% FBS was added onto a basolateral chamber. The insert used for Transwell invasion assay was encased with matrigel at 37°C for 2 h. Twenty four hours later, cells on the surface of the apical membrane were wiped off, and the cells passing the insert were maintained in 4% paraformaldehyde for 30 min. After being fixed, the cells were dyed with 10% Giemsa and rinsed with PBS three times and observed using an inverted microscope. The number of invasive cells was counted at the magnification of × 200 from 5 random fields and then averaged. The number of cells invaded and migrated in the control group was defined as 1, and normalized fold changes of invasive and migratory cells in the experimental groups were accordingly calculated. The results were acquired from three independent experiments.
A RIP kit was purchased from Guangzhou Saicheng Biotechnology Co., Ltd. (KT102–01, Guangdong, China). Approximate 4 × 107 cells were homogenized with lysis buffer (1 ml) and rotated in a 4°C refrigerator for 1–2 h. Afterward, the cells were centrifuged at 4°C and 14,000 rpm for 10 min, and 10 μL of the supernatant was collected and termed Input group. A total volume of 100 μL of the supernatant was incubated with bead-antibody (5 μg, ab191250, ab75974, ab108252, abcam, Cambridge, and United Kingdom) complexes at 4°C overnight, and then the supernatant was removed on a magnetic rack. Subsequently, 1 ml of RIP buffer was added to wash the complexes and then the supernatant was discarded. Thereafter, each group (including Input group) was incubated with 117 μL of RIP buffer, 15 μL of 10% SDS, and 18 μL of proteinase K at 65°C for 45 min before being centrifuged at 3,000 rpm for 5 min. The supernatant from IP group were added with 250 μL of RIP wash buffer and 400 μL of the homogenate of phenol, chloroform and isoamylol (125:24:1) and mixed by vortexing. After being maintained at room temperature for 5 min, the mixture was centrifuged at 12,000 rpm and room temperature for 15 min. Upper aqueous phase (400 μL) was collected and then mixed with 1.2 ml of absolute ethanol and 2 μL of glycogen for precipitation overnight at −20°C. After precipitation, the mixture was centrifuged at 12,000 rpm and 4°C for 30 min. The supernatant was discarded before the beads were rinsed with 75% ethanol. The beads were centrifuged again, and the supernatant was removed. Finally, the beads were dissolved in DEPC, and RNAs were analyzed by qRT-PCR.
Specific FISH was conducted using LINC-PINT probes. The 5′CY3 labeled LINC-PINT probes were synthesized by Shanghai Genechem Co., Ltd. (Shanghai, China). All operations were made according to the instruction of the FISH kit (F03401, Genechem, Shanghai, China). Briefly, cells on the slides were fixed with ice-cold 4% paraformaldehyde and degraded at 70°C. The cells were incubated with 30 μg/ml LINC-PINT probes and then counterstained with DAPI after the residual probes were washed off. Finally, the cells were visualized and photographed under a fluorescent microscope.
Cells were lyzed to extract proteins, and then the isolated proteins were incubated with anti-EZH2 antibody (ab186006, abcam, Cambridge, United Kingdom) and 20 μL of protein-A/G-agarose beads at 4°C overnight. Following incubation, the precipitation was washed with lysis buffer four times and suspended in 5 × SDS-PAGE loading buffer. The suspension was boiled for 5 min before Western blot analysis.
Statistical analysis was carried out by using SPSS 18.0 (IBM Corp., Armonk, NY, United States) and GraphPad Prism 6.0 (GraphPad Software Inc.). Results in this study were from three independent experiments unless otherwise stated and the data were presented as average ± standard deviation.
The clinical data of 30 patients enrolled in this study are presented in
Clinical data of 30 patients enrolled in this study.
Number (n) | ||
---|---|---|
Age (y) | <60 | 15 |
≥60 | 15 | |
Sex | Male | 15 |
Female | 15 | |
TNM stage | Ⅰ | 6 |
Ⅱ | 6 | |
Ⅲ | 5 | |
Ⅳ | 13 | |
Differentiation | Well | 8 |
Moderate | 11 | |
Poor | 11 | |
Lymph node metastasis | Yes | 18 |
No | 12 |
TNM, tumor node metastasis.
Downregulation of LINC-PINT associates with the poor prognosis of LSCC patients. Note: qRT-PCR analysis of LINC-PINT expression in LSCC and ANM tissues (
To determine the functional role of LINC-PINT in cancer development, a Hela derivative Hep-2 and an LSCC cell line TU-177 were selected. qRT-PCR analysis of LINC-PINT expression exhibited a great decrease in Hep-2 and TU-177 cells compared to that in NHOK cells (
LINC-PINT mediates cell proliferation, migration and invasion. Note: Hep-2 and TU-177 cells were transfected with pcDNA3.1-LINC-PINT and sh-LINC-PINT. qRT-PCR detected the expression of LINC-PINT in Hep-2 and TU-177 cells (
To further illuminate the underlying mechanism by which LINC-PINT regulates cancer development, we investigated the target genes of LINC-PINT. Initially, the content of LINC-PINT in the cytoplasm and nuclei of Hep2 and TU-177 cells was analyzed by qRT-PCR analysis. The results revealed that LINC-PINT mainly expressed in the nuclei of Hep-2 and TU-177 (
LINC-PINT enriches EZH2 to inhibit ZEB1. Note: Analysis of nuclear/cytoplasmic distribution of LINC-PINT and qRT-PCR analysis verified that LINC-PINT mainly expressed in the nuclei of Hep-2 and TU-177 cells (
Next, we screened the downstream genes of EZH2 to explore which genes were regulated by EZH2 in the LSCC cell line TU-177 and Hep-2 carcinoma cells. Hep-2 and TU-177 cells were cultured with pcDNA3.1-EZH2 or sh-EZH2, and then the expression levels of CDKN1C, ACE2, Robo4, KLF2, P4HA1, DUXAP8, DKK-1, and ZEB1 were quantified by qRT-PCR and Western blotting. In cells transfected with pcDNA3.1-EZH2, the expression levels of CDKN1C, ACE2, and ZEB1 were increased, while the levels of DUXAP8, DKK-1, and KLF2 were downregulated; Hep2 and TU-177 cells from the sh-EZH2 group presented massive decreases in the levels of CDKN1C, ACE2, and ZEB1 as well as increases in the levels of DUXAP8, DKK-1, and KLF2 (
The expression of ZEB1 in LSCC tissues was measured to disclose the effect of ZEB1 on LSCC progression. Compared with the ANM tissues, the mRNA level of ZEB1 was upregulated in the LSCC tissues (
ZEB1 silencing inhibits cell migration and invasion. Note: qRT-PCR analysis detected the mRNA expression of ZEB1 in LSCC and ANM tissues (
Based on the aforementioned findings, we next revealed whether LINC-PINT could inhibit cancer cell propagation, invasion and migration via ZEB1. Hep-2 and TU-177 cells were, respectively, introduced with pcDNA-3.1-LINC-PINT and sh-LINC-PINT, and then the expression of ZEB1 was assessed by qRT-PCR and Western blot analyses. Gain- or loss-of function experiment manifested that the mRNA and protein expression levels of ZEB1 were downregulated in the pcDNA3.1-LINC-PINT group and upregulated in the sh-LINC-PINT group (
Then, Hep-2 and TU-177 cells were transfected with pcDNA3.1-LINC-PINT, pcDNA3.1-ZEB1 or co-transfected with pcDNA3.1-LINC-PINT and pcDNA3.1-ZEB1, and cell proliferation, migration and invasion abilities were detected. As expected, the propagation, and invasion and migration rates of Hep2 and TU-177 cells were enhanced in the pcDNA3.1-ZEB1 group (vs. the Control group), and the cell viability and invasion and migration abilities were also increased in the pcDNA3.1-LINC-PINT + pcDNA3.1-ZEB1 group compared to the pcDNA3.1-LINC-PINT group (
To elucidate the mechanism regarding LINC-PINT regulating cancer progression, we determined the expression levels of AKT, mTOR, RPS6KB1 (S6K1) and their phosphorylated proteins in Hep-2 and TU-177 cells transfected with pcDNA3.1-LINC-PINT and sh-LINC-PINT. As shown in
LINC-PINT regulates the AKT/mTOR signaling
Admittedly, ectopic expression of lncRNAs is responsible for various malignant processes in LSCC [
Firstly, LINC-PINT expression was identified to be inhibited both in LSCC tissues and Hep-2 and TU-177 cells. The downregulation of LINC-PINT related to dismal prognosis and unfavourable clinicopathological characteristics, including advanced TNM stage, differentiation and lymph node metastasis for LSCC patients. Our
We next observed that LINC-PINT could bind and downregulate EZH2. EZH2 is an enzymatic subunit of PRC2, and PRC2 is a complex that promotes transcriptional silencing through methylating lysine 27 of histone H3 [
In addition, LINC-PINT inhibition increased the phosphorylated levels of the AKT/mTOR pathway-related proteins. The activation of the AKT/mTOR signaling pathway is thought to enhance cancer cell proliferation in LSCC [
In summary, the present study quantified the changes of LINC-PINT expression in LSCC tissues and in the LSCC cell line TU-177 and Hep-2 carcinoma cells and elucidated the inhibitory functions and action mechanism of LINC-PINT on LSCC development, suggesting a prognostic marker and a potent therapeutic direction for LSCC treatment.
The authors acknowledge that the data presented in this study must be deposited and made publicly available in an acceptable repository, prior to publication. Frontiers cannot accept a article that does not adhere to our open data policies.
The studies involving human participants were reviewed and approved by Harbin Medical University Cancer Hospital. The patients/participants provided their written informed consent to participate in this study.
YXG and JSS conceived the ideas. YXG and JSS designed the experiments. MSS; MXH and XC performed the experiments. SJ and MXH analyzed the data. YXG and PR provided critical materials. YXG and MSS wrote the manuscript. JSS supervised the study. All the authors have read and approved the final version for publication.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The Supplementary Material for this article can be found online at: